Review



trim21  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Santa Cruz Biotechnology trim21
    IFI35 ubiquitinates HNF4a in <t>TRIM21-dependent</t> manner. A Cell lysates were immunoprecipitated using an anti-TRIM21 antibody. B Detection of HBV DNAs by Southern blot from HepG2 and HepG2-TRIM21-KO cells. Expression levels of HNF4α, IFI35 and TRIM21 in HepG2-TRIM21-KO cells compared to parental HepG2 cells (Control) were assessed by Western blot. HBV DNA levels of HepG2 and HepG2-TRIM21-KO cells were quantified in graph (bottom). C Quantification of HNF4α protein levels in HepG2 and HepG2-TRIM21 knockout (KO) cells transfected with increasing amounts of myc-IFI35. HNF4α levels were determined by immunoblotting and quantified relative to the vector control. Data represent mean ± SD from three independent experiments. D Secreted HBeAg and HBsAg levels were measured by ELISA in HepG2 and HepG2-TRIM21-KO cells transfected with increasing amounts of myc-IFI35. Data represent mean ± SD from three independent experiments. E HepG2 or HepG2-TRIM21 knockout cells were transfected with HBV 1.2mer together with increasing amounts of IFI35. Total RNA was analyzed by Northern blotting to detect HBV transcription. F Effect of TRIM21 on IFI35-mediated HNF4α degradation. HepG2 and HepG2-TRIM21-KO cells were transfected with either empty vector or myc-IFI35. After 48 h, cycloheximide (50ug/ml) were treated for the indicated times, and cells were harvested. Expression levels of HNF4α and IFI35 were evaluated through Western blotting. Quantification of HNF4α levels between HepG2 and HepG2-TRIM21-KO cells (bottom). G HepG2 cells and TRIM21 knockout cells were co-transfected with HA-tagged ubiquitin (1 μg) and either vector or IFI35 (2 μg). At 48 h post-transfection, HNF4α was immunoprecipitated and immunoblotted with anti-ubiquitin antibody to assess polyubiquitination. Total levels of HNF4α, IFI35, TRIM21, and HA-tagged ubiquitin in input lysates were also analyzed by immunoblotting. H Schematic diagram of HBV enhancer luciferase reporter constructs. Constructs containing enhancer I (EnhI), enhancer II (EnhII), or both regions were cloned upstream of the luciferase reporter gene. Mutant constructs lacking HNF4α binding sites were generated in EnhI (ΔHNF4α) or EnhII (ΔHNF4α1 and ΔHNF4α1,2) as indicated. I Basal luciferase activity of HBV enhancer reporter constructs. HepG2 cells were transfected with the indicated luciferase reporter plasmids, and luciferase activity was measured. J Comparison of the effect of IFI35 on EnhI-driven transcription with or without the HNF4α binding site. HepG2 cells were co-transfected with the indicated EnhI luciferase reporters and increasing amounts of myc-IFI35. Luciferase activity was measured 48 h post-transfection. Data represent mean ± SD from three independent experiments. K Comparison of the effect of IFI35 on EnhII-driven transcription with or without HNF4α binding sites. HepG2 cells were co-transfected with EnhII luciferase reporters containing wild-type or mutated HNF4α binding sites together with increasing amounts of myc-IFI35. Luciferase activity was measured 48 h post-transfection. Data represent mean ± SD from three independent experiments. The above experiment was independently conducted three times. Data are shown as mean ± SD. The statistical significance of the differences was assessed by the Student t test: *, P < 0.05; **, P < 0.01, ***, P < 0.001
    Trim21, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 50 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trim21/product/Santa Cruz Biotechnology
    Average 93 stars, based on 50 article reviews
    trim21 - by Bioz Stars, 2026-06
    93/100 stars

    Images

    1) Product Images from "IFI35 suppresses the transcription of hepatitis B virus cccDNA minichromosome via promoting HNF4α proteasomal degradation"

    Article Title: IFI35 suppresses the transcription of hepatitis B virus cccDNA minichromosome via promoting HNF4α proteasomal degradation

    Journal: Journal of Biomedical Science

    doi: 10.1186/s12929-026-01239-w

    IFI35 ubiquitinates HNF4a in TRIM21-dependent manner. A Cell lysates were immunoprecipitated using an anti-TRIM21 antibody. B Detection of HBV DNAs by Southern blot from HepG2 and HepG2-TRIM21-KO cells. Expression levels of HNF4α, IFI35 and TRIM21 in HepG2-TRIM21-KO cells compared to parental HepG2 cells (Control) were assessed by Western blot. HBV DNA levels of HepG2 and HepG2-TRIM21-KO cells were quantified in graph (bottom). C Quantification of HNF4α protein levels in HepG2 and HepG2-TRIM21 knockout (KO) cells transfected with increasing amounts of myc-IFI35. HNF4α levels were determined by immunoblotting and quantified relative to the vector control. Data represent mean ± SD from three independent experiments. D Secreted HBeAg and HBsAg levels were measured by ELISA in HepG2 and HepG2-TRIM21-KO cells transfected with increasing amounts of myc-IFI35. Data represent mean ± SD from three independent experiments. E HepG2 or HepG2-TRIM21 knockout cells were transfected with HBV 1.2mer together with increasing amounts of IFI35. Total RNA was analyzed by Northern blotting to detect HBV transcription. F Effect of TRIM21 on IFI35-mediated HNF4α degradation. HepG2 and HepG2-TRIM21-KO cells were transfected with either empty vector or myc-IFI35. After 48 h, cycloheximide (50ug/ml) were treated for the indicated times, and cells were harvested. Expression levels of HNF4α and IFI35 were evaluated through Western blotting. Quantification of HNF4α levels between HepG2 and HepG2-TRIM21-KO cells (bottom). G HepG2 cells and TRIM21 knockout cells were co-transfected with HA-tagged ubiquitin (1 μg) and either vector or IFI35 (2 μg). At 48 h post-transfection, HNF4α was immunoprecipitated and immunoblotted with anti-ubiquitin antibody to assess polyubiquitination. Total levels of HNF4α, IFI35, TRIM21, and HA-tagged ubiquitin in input lysates were also analyzed by immunoblotting. H Schematic diagram of HBV enhancer luciferase reporter constructs. Constructs containing enhancer I (EnhI), enhancer II (EnhII), or both regions were cloned upstream of the luciferase reporter gene. Mutant constructs lacking HNF4α binding sites were generated in EnhI (ΔHNF4α) or EnhII (ΔHNF4α1 and ΔHNF4α1,2) as indicated. I Basal luciferase activity of HBV enhancer reporter constructs. HepG2 cells were transfected with the indicated luciferase reporter plasmids, and luciferase activity was measured. J Comparison of the effect of IFI35 on EnhI-driven transcription with or without the HNF4α binding site. HepG2 cells were co-transfected with the indicated EnhI luciferase reporters and increasing amounts of myc-IFI35. Luciferase activity was measured 48 h post-transfection. Data represent mean ± SD from three independent experiments. K Comparison of the effect of IFI35 on EnhII-driven transcription with or without HNF4α binding sites. HepG2 cells were co-transfected with EnhII luciferase reporters containing wild-type or mutated HNF4α binding sites together with increasing amounts of myc-IFI35. Luciferase activity was measured 48 h post-transfection. Data represent mean ± SD from three independent experiments. The above experiment was independently conducted three times. Data are shown as mean ± SD. The statistical significance of the differences was assessed by the Student t test: *, P < 0.05; **, P < 0.01, ***, P < 0.001
    Figure Legend Snippet: IFI35 ubiquitinates HNF4a in TRIM21-dependent manner. A Cell lysates were immunoprecipitated using an anti-TRIM21 antibody. B Detection of HBV DNAs by Southern blot from HepG2 and HepG2-TRIM21-KO cells. Expression levels of HNF4α, IFI35 and TRIM21 in HepG2-TRIM21-KO cells compared to parental HepG2 cells (Control) were assessed by Western blot. HBV DNA levels of HepG2 and HepG2-TRIM21-KO cells were quantified in graph (bottom). C Quantification of HNF4α protein levels in HepG2 and HepG2-TRIM21 knockout (KO) cells transfected with increasing amounts of myc-IFI35. HNF4α levels were determined by immunoblotting and quantified relative to the vector control. Data represent mean ± SD from three independent experiments. D Secreted HBeAg and HBsAg levels were measured by ELISA in HepG2 and HepG2-TRIM21-KO cells transfected with increasing amounts of myc-IFI35. Data represent mean ± SD from three independent experiments. E HepG2 or HepG2-TRIM21 knockout cells were transfected with HBV 1.2mer together with increasing amounts of IFI35. Total RNA was analyzed by Northern blotting to detect HBV transcription. F Effect of TRIM21 on IFI35-mediated HNF4α degradation. HepG2 and HepG2-TRIM21-KO cells were transfected with either empty vector or myc-IFI35. After 48 h, cycloheximide (50ug/ml) were treated for the indicated times, and cells were harvested. Expression levels of HNF4α and IFI35 were evaluated through Western blotting. Quantification of HNF4α levels between HepG2 and HepG2-TRIM21-KO cells (bottom). G HepG2 cells and TRIM21 knockout cells were co-transfected with HA-tagged ubiquitin (1 μg) and either vector or IFI35 (2 μg). At 48 h post-transfection, HNF4α was immunoprecipitated and immunoblotted with anti-ubiquitin antibody to assess polyubiquitination. Total levels of HNF4α, IFI35, TRIM21, and HA-tagged ubiquitin in input lysates were also analyzed by immunoblotting. H Schematic diagram of HBV enhancer luciferase reporter constructs. Constructs containing enhancer I (EnhI), enhancer II (EnhII), or both regions were cloned upstream of the luciferase reporter gene. Mutant constructs lacking HNF4α binding sites were generated in EnhI (ΔHNF4α) or EnhII (ΔHNF4α1 and ΔHNF4α1,2) as indicated. I Basal luciferase activity of HBV enhancer reporter constructs. HepG2 cells were transfected with the indicated luciferase reporter plasmids, and luciferase activity was measured. J Comparison of the effect of IFI35 on EnhI-driven transcription with or without the HNF4α binding site. HepG2 cells were co-transfected with the indicated EnhI luciferase reporters and increasing amounts of myc-IFI35. Luciferase activity was measured 48 h post-transfection. Data represent mean ± SD from three independent experiments. K Comparison of the effect of IFI35 on EnhII-driven transcription with or without HNF4α binding sites. HepG2 cells were co-transfected with EnhII luciferase reporters containing wild-type or mutated HNF4α binding sites together with increasing amounts of myc-IFI35. Luciferase activity was measured 48 h post-transfection. Data represent mean ± SD from three independent experiments. The above experiment was independently conducted three times. Data are shown as mean ± SD. The statistical significance of the differences was assessed by the Student t test: *, P < 0.05; **, P < 0.01, ***, P < 0.001

    Techniques Used: Immunoprecipitation, Southern Blot, Expressing, Control, Western Blot, Knock-Out, Transfection, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Northern Blot, Ubiquitin Proteomics, Luciferase, Construct, Clone Assay, Mutagenesis, Binding Assay, Generated, Activity Assay, Comparison

    Domain mapping of IFI35 as mediators of TRIM21–HNF4α complex formation. A Schematic representation of IFI35 constructs used in this study. GFP-tagged mutants lacking NID1 (ΔNID1) or NID2 (ΔNID2), as well as the leucine zipper construct (Zip), were generated. B HepG2 cells were co-transfected with HBV 1.2mer and the indicated IFI35 constructs. At 72 h post-transfection, HBV replication intermediates were analyzed by Southern blotting. Quantification of HBV replication levels based on Southern blot analysis. C Secreted HBeAg and HBsAg levels in the culture supernatants were measured by ELISA. E Co-immunoprecipitation analysis of IFI35 mutants with HNF4α. HepG2 cells were transfected with GFP-tagged IFI35 constructs and cell lysates were immunoprecipitated using anti-HNF4α antibody followed by immunoblotting with anti-GFP antibody. F Interaction of IFI35 mutants with TRIM21. Cells were transfected with Myc-TRIM21 together with the indicated IFI35 constructs. Cell lysates were subjected to immunoprecipitation using anti-TRIM21 antibody followed by immunoblotting with anti-GFP antibody. Data represent mean ± SD (n = 3). Statistical significance was determined relative to the vector control
    Figure Legend Snippet: Domain mapping of IFI35 as mediators of TRIM21–HNF4α complex formation. A Schematic representation of IFI35 constructs used in this study. GFP-tagged mutants lacking NID1 (ΔNID1) or NID2 (ΔNID2), as well as the leucine zipper construct (Zip), were generated. B HepG2 cells were co-transfected with HBV 1.2mer and the indicated IFI35 constructs. At 72 h post-transfection, HBV replication intermediates were analyzed by Southern blotting. Quantification of HBV replication levels based on Southern blot analysis. C Secreted HBeAg and HBsAg levels in the culture supernatants were measured by ELISA. E Co-immunoprecipitation analysis of IFI35 mutants with HNF4α. HepG2 cells were transfected with GFP-tagged IFI35 constructs and cell lysates were immunoprecipitated using anti-HNF4α antibody followed by immunoblotting with anti-GFP antibody. F Interaction of IFI35 mutants with TRIM21. Cells were transfected with Myc-TRIM21 together with the indicated IFI35 constructs. Cell lysates were subjected to immunoprecipitation using anti-TRIM21 antibody followed by immunoblotting with anti-GFP antibody. Data represent mean ± SD (n = 3). Statistical significance was determined relative to the vector control

    Techniques Used: Construct, Generated, Transfection, Southern Blot, Enzyme-linked Immunosorbent Assay, Immunoprecipitation, Western Blot, Plasmid Preparation, Control



    Similar Products

    94
    MedChemExpress constipation mouse model
    Constipation Mouse Model, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/constipation mouse model/product/MedChemExpress
    Average 94 stars, based on 1 article reviews
    constipation mouse model - by Bioz Stars, 2026-06
    94/100 stars
      Buy from Supplier

    86
    Huabio Inc anti trim21
    Anti Trim21, supplied by Huabio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti trim21/product/Huabio Inc
    Average 86 stars, based on 1 article reviews
    anti trim21 - by Bioz Stars, 2026-06
    86/100 stars
      Buy from Supplier

    86
    Azenta mouse trim21 full length
    Mouse Trim21 Full Length, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse trim21 full length/product/Azenta
    Average 86 stars, based on 1 article reviews
    mouse trim21 full length - by Bioz Stars, 2026-06
    86/100 stars
      Buy from Supplier

    86
    Genechem trim21
    Trim21, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trim21/product/Genechem
    Average 86 stars, based on 1 article reviews
    trim21 - by Bioz Stars, 2026-06
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech cgaggtgatctcaaagcaata sangon biotech n a shrna trim21
    Cgaggtgatctcaaagcaata Sangon Biotech N A Shrna Trim21, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cgaggtgatctcaaagcaata sangon biotech n a shrna trim21/product/Sangon Biotech
    Average 86 stars, based on 1 article reviews
    cgaggtgatctcaaagcaata sangon biotech n a shrna trim21 - by Bioz Stars, 2026-06
    86/100 stars
      Buy from Supplier

    96
    Proteintech anti trim21
    Anti Trim21, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti trim21/product/Proteintech
    Average 96 stars, based on 1 article reviews
    anti trim21 - by Bioz Stars, 2026-06
    96/100 stars
      Buy from Supplier

    86
    Cell Signaling Technology Inc anti trim21
    Anti Trim21, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti trim21/product/Cell Signaling Technology Inc
    Average 86 stars, based on 1 article reviews
    anti trim21 - by Bioz Stars, 2026-06
    86/100 stars
      Buy from Supplier

    94
    Cell Signaling Technology Inc trim21 antibody
    High expression of tripartite motif-containing protein 21 <t>(TRIM21)</t> in ovarian granulosa cells (GCs) of polycystic ovary syndrome (PCOS) mice. (A) Schematic illustration showing the induction of PCOS by prenatal anti-Müllerian hormone (PAMH) treatment. (B) Estrous cycle of adult female mice for 21 consecutive days ( n = 5). (C and D) Glucose tolerance test and insulin tolerance test after 16 h of fasting and 4 h of fasting in adult female mice ( n = 5). (E) Anogenital distance in adult female mice ( n = 15). (F) Number of pups per birth ( n = 10). (G and H) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (I) Hematoxylin and eosin (H&E) staining of ovaries showing primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (J and K) Volcano plots showing differentially expressed proteins and genes in the ovaries of control and PAMH F 1 mice (up-regulated, red; down-regulated, blue; n = 3). (L) Up-regulated proteins and genes determined by proteomic and transcriptomic analysis. (M and N) Western blot (WB) and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 in mouse ovarian tissues. (O and P) WB and RT-PCR analysis of TRIM21 in mouse GCs. (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (C and D) was determined by 2-way ANOVA and multiple comparison test. ** P < 0.01; *** P < 0.001; **** P < 0.0001.
    Trim21 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trim21 antibody/product/Cell Signaling Technology Inc
    Average 94 stars, based on 1 article reviews
    trim21 antibody - by Bioz Stars, 2026-06
    94/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology trim21
    IFI35 ubiquitinates HNF4a in <t>TRIM21-dependent</t> manner. A Cell lysates were immunoprecipitated using an anti-TRIM21 antibody. B Detection of HBV DNAs by Southern blot from HepG2 and HepG2-TRIM21-KO cells. Expression levels of HNF4α, IFI35 and TRIM21 in HepG2-TRIM21-KO cells compared to parental HepG2 cells (Control) were assessed by Western blot. HBV DNA levels of HepG2 and HepG2-TRIM21-KO cells were quantified in graph (bottom). C Quantification of HNF4α protein levels in HepG2 and HepG2-TRIM21 knockout (KO) cells transfected with increasing amounts of myc-IFI35. HNF4α levels were determined by immunoblotting and quantified relative to the vector control. Data represent mean ± SD from three independent experiments. D Secreted HBeAg and HBsAg levels were measured by ELISA in HepG2 and HepG2-TRIM21-KO cells transfected with increasing amounts of myc-IFI35. Data represent mean ± SD from three independent experiments. E HepG2 or HepG2-TRIM21 knockout cells were transfected with HBV 1.2mer together with increasing amounts of IFI35. Total RNA was analyzed by Northern blotting to detect HBV transcription. F Effect of TRIM21 on IFI35-mediated HNF4α degradation. HepG2 and HepG2-TRIM21-KO cells were transfected with either empty vector or myc-IFI35. After 48 h, cycloheximide (50ug/ml) were treated for the indicated times, and cells were harvested. Expression levels of HNF4α and IFI35 were evaluated through Western blotting. Quantification of HNF4α levels between HepG2 and HepG2-TRIM21-KO cells (bottom). G HepG2 cells and TRIM21 knockout cells were co-transfected with HA-tagged ubiquitin (1 μg) and either vector or IFI35 (2 μg). At 48 h post-transfection, HNF4α was immunoprecipitated and immunoblotted with anti-ubiquitin antibody to assess polyubiquitination. Total levels of HNF4α, IFI35, TRIM21, and HA-tagged ubiquitin in input lysates were also analyzed by immunoblotting. H Schematic diagram of HBV enhancer luciferase reporter constructs. Constructs containing enhancer I (EnhI), enhancer II (EnhII), or both regions were cloned upstream of the luciferase reporter gene. Mutant constructs lacking HNF4α binding sites were generated in EnhI (ΔHNF4α) or EnhII (ΔHNF4α1 and ΔHNF4α1,2) as indicated. I Basal luciferase activity of HBV enhancer reporter constructs. HepG2 cells were transfected with the indicated luciferase reporter plasmids, and luciferase activity was measured. J Comparison of the effect of IFI35 on EnhI-driven transcription with or without the HNF4α binding site. HepG2 cells were co-transfected with the indicated EnhI luciferase reporters and increasing amounts of myc-IFI35. Luciferase activity was measured 48 h post-transfection. Data represent mean ± SD from three independent experiments. K Comparison of the effect of IFI35 on EnhII-driven transcription with or without HNF4α binding sites. HepG2 cells were co-transfected with EnhII luciferase reporters containing wild-type or mutated HNF4α binding sites together with increasing amounts of myc-IFI35. Luciferase activity was measured 48 h post-transfection. Data represent mean ± SD from three independent experiments. The above experiment was independently conducted three times. Data are shown as mean ± SD. The statistical significance of the differences was assessed by the Student t test: *, P < 0.05; **, P < 0.01, ***, P < 0.001
    Trim21, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trim21/product/Santa Cruz Biotechnology
    Average 93 stars, based on 1 article reviews
    trim21 - by Bioz Stars, 2026-06
    93/100 stars
      Buy from Supplier

    Image Search Results


    High expression of tripartite motif-containing protein 21 (TRIM21) in ovarian granulosa cells (GCs) of polycystic ovary syndrome (PCOS) mice. (A) Schematic illustration showing the induction of PCOS by prenatal anti-Müllerian hormone (PAMH) treatment. (B) Estrous cycle of adult female mice for 21 consecutive days ( n = 5). (C and D) Glucose tolerance test and insulin tolerance test after 16 h of fasting and 4 h of fasting in adult female mice ( n = 5). (E) Anogenital distance in adult female mice ( n = 15). (F) Number of pups per birth ( n = 10). (G and H) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (I) Hematoxylin and eosin (H&E) staining of ovaries showing primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (J and K) Volcano plots showing differentially expressed proteins and genes in the ovaries of control and PAMH F 1 mice (up-regulated, red; down-regulated, blue; n = 3). (L) Up-regulated proteins and genes determined by proteomic and transcriptomic analysis. (M and N) Western blot (WB) and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 in mouse ovarian tissues. (O and P) WB and RT-PCR analysis of TRIM21 in mouse GCs. (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (C and D) was determined by 2-way ANOVA and multiple comparison test. ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Journal: Research

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A

    doi: 10.34133/research.1223

    Figure Lengend Snippet: High expression of tripartite motif-containing protein 21 (TRIM21) in ovarian granulosa cells (GCs) of polycystic ovary syndrome (PCOS) mice. (A) Schematic illustration showing the induction of PCOS by prenatal anti-Müllerian hormone (PAMH) treatment. (B) Estrous cycle of adult female mice for 21 consecutive days ( n = 5). (C and D) Glucose tolerance test and insulin tolerance test after 16 h of fasting and 4 h of fasting in adult female mice ( n = 5). (E) Anogenital distance in adult female mice ( n = 15). (F) Number of pups per birth ( n = 10). (G and H) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (I) Hematoxylin and eosin (H&E) staining of ovaries showing primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (J and K) Volcano plots showing differentially expressed proteins and genes in the ovaries of control and PAMH F 1 mice (up-regulated, red; down-regulated, blue; n = 3). (L) Up-regulated proteins and genes determined by proteomic and transcriptomic analysis. (M and N) Western blot (WB) and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 in mouse ovarian tissues. (O and P) WB and RT-PCR analysis of TRIM21 in mouse GCs. (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (C and D) was determined by 2-way ANOVA and multiple comparison test. ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Article Snippet: Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300).

    Techniques: Expressing, Staining, Control, Western Blot, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Immunohistochemical staining, Comparison

    Tripartite motif-containing protein 21 (TRIM21) is associated with fatty acid oxidation (FAO) in ovarian granulosa cells. (A) Volcano plot for the significant ( P < 0.05) alterations in protein expression induced by TRIM21 knockdown ( n = 3). (B) Heatmap plot showing differentially expressed proteins ( n = 3). (C) Gene Ontology (GO) enrichment analysis of the proteomic sequencing. (D and E) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR) in KGN cells, including basal respiration, maximum respiration, adenosine triphosphate (ATP) production, and coupling efficiency ( n = 6). (F) Evaluation of the glycolysis function by extracellular acidification rate (ECAR) in KGN cells ( n = 3). (G and H) Evaluation of FAO-dependent mitochondrial function by OCR in KGN cells, including basal respiration and maximum respiration ( n = 6). (I) transmission electron microscopy (TEM) analysis of mitochondrial morphology in KGN cell. Green arrows indicate normal mitochondria, and red arrows indicate abnormal mitochondria ( n = 5; scale bars, 2 μm). (J) Representative images for JC-1 ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities in KGN cells. (K) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities in KGN cells. (L) Activity of mitochondrial complexes I to V in KGN cells ( n = 6). (M) Western blot (WB) analysis of OXPHOS subunits (complex I-NDUFB8, complex II-SDHB, complex III-UQCRC2, complex IV-MTCO1, and complex V-ATP5A1) of KGN cells. Data are expressed as means ± standard error of the mean (SEM). ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Journal: Research

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A

    doi: 10.34133/research.1223

    Figure Lengend Snippet: Tripartite motif-containing protein 21 (TRIM21) is associated with fatty acid oxidation (FAO) in ovarian granulosa cells. (A) Volcano plot for the significant ( P < 0.05) alterations in protein expression induced by TRIM21 knockdown ( n = 3). (B) Heatmap plot showing differentially expressed proteins ( n = 3). (C) Gene Ontology (GO) enrichment analysis of the proteomic sequencing. (D and E) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR) in KGN cells, including basal respiration, maximum respiration, adenosine triphosphate (ATP) production, and coupling efficiency ( n = 6). (F) Evaluation of the glycolysis function by extracellular acidification rate (ECAR) in KGN cells ( n = 3). (G and H) Evaluation of FAO-dependent mitochondrial function by OCR in KGN cells, including basal respiration and maximum respiration ( n = 6). (I) transmission electron microscopy (TEM) analysis of mitochondrial morphology in KGN cell. Green arrows indicate normal mitochondria, and red arrows indicate abnormal mitochondria ( n = 5; scale bars, 2 μm). (J) Representative images for JC-1 ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities in KGN cells. (K) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities in KGN cells. (L) Activity of mitochondrial complexes I to V in KGN cells ( n = 6). (M) Western blot (WB) analysis of OXPHOS subunits (complex I-NDUFB8, complex II-SDHB, complex III-UQCRC2, complex IV-MTCO1, and complex V-ATP5A1) of KGN cells. Data are expressed as means ± standard error of the mean (SEM). ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Article Snippet: Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300).

    Techniques: Expressing, Knockdown, Sequencing, Phospho-proteomics, Transmission Assay, Electron Microscopy, Fluorescence, Activity Assay, Western Blot

    Tripartite motif-containing protein 21 (TRIM21) regulates fatty acid oxidation in granulosa cells through carnitine palmitoyltransferase 1A (CPT1A). (A) CPT1A was identified as a protein with high confidence interacting with TRIM21 by immunoprecipitation-mass spectrometry (IP-MS) and proteomic sequencing. (B) Western blot (WB) analysis of KGN cell lysates immunoprecipitated with TRIM21 or CPT1A antibodies. (C and D) Coimmunoprecipitation (Co-IP) and WB analysis of exogenous TRIM21 and CPT1A in KGN cells overexpressing Myc-TRIM21 and Flag- CPT1A. (E) Immunofluorescence staining ofTRIM21 and CPT1A by confocal microscopy (scale bar, 10 μm) in KGN cells. (F) Molecular docking of TRIM21 and CPT1A. (G) Microscale thermophoresis of TRIM21 and CPT1A. (H to J) WB analysis of CPT1A with TRIM21 silencing or overexpression in KGN cells. (K) WB analysis of ATP5A1 with CPT1A silencing, with or without TRIM21 knockdown in KGN cells. (L) WB analysis of ATP5A1 in cells with etomoxir, with or without TRIM21 knockdown in KGN cells. (M and N) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR), including basal respiration and maximum respiration ( n = 6). (O) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) in oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. (P) Representative images for lipid content in oocytes by ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. Data are expressed as means ± standard error of the mean (SEM). ns, not significant; **** P < 0.0001. IB, immunoblot.

    Journal: Research

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A

    doi: 10.34133/research.1223

    Figure Lengend Snippet: Tripartite motif-containing protein 21 (TRIM21) regulates fatty acid oxidation in granulosa cells through carnitine palmitoyltransferase 1A (CPT1A). (A) CPT1A was identified as a protein with high confidence interacting with TRIM21 by immunoprecipitation-mass spectrometry (IP-MS) and proteomic sequencing. (B) Western blot (WB) analysis of KGN cell lysates immunoprecipitated with TRIM21 or CPT1A antibodies. (C and D) Coimmunoprecipitation (Co-IP) and WB analysis of exogenous TRIM21 and CPT1A in KGN cells overexpressing Myc-TRIM21 and Flag- CPT1A. (E) Immunofluorescence staining ofTRIM21 and CPT1A by confocal microscopy (scale bar, 10 μm) in KGN cells. (F) Molecular docking of TRIM21 and CPT1A. (G) Microscale thermophoresis of TRIM21 and CPT1A. (H to J) WB analysis of CPT1A with TRIM21 silencing or overexpression in KGN cells. (K) WB analysis of ATP5A1 with CPT1A silencing, with or without TRIM21 knockdown in KGN cells. (L) WB analysis of ATP5A1 in cells with etomoxir, with or without TRIM21 knockdown in KGN cells. (M and N) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR), including basal respiration and maximum respiration ( n = 6). (O) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) in oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. (P) Representative images for lipid content in oocytes by ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. Data are expressed as means ± standard error of the mean (SEM). ns, not significant; **** P < 0.0001. IB, immunoblot.

    Article Snippet: Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300).

    Techniques: Immunoprecipitation, Mass Spectrometry, Protein-Protein interactions, Sequencing, Western Blot, Co-Immunoprecipitation Assay, Immunofluorescence, Staining, Confocal Microscopy, Microscale Thermophoresis, Over Expression, Knockdown, Phospho-proteomics, Fluorescence

    Tripartite motif-containing protein 21 (TRIM21) facilitates ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) at lysine 161. (A) Reverse transcription polymerase chain reaction (RT-PCR) analysis of CPT1A with or without TRIM21 knockdown of KGN and COV434 cells ( n = 5). (B) Western blot (WB) analysis of CPT1A with TRIM21 overexpression in the presence of MG132 in KGN cells. (C) WB analysis of CPT1A in KGN cells treated with cycloheximide (CHX) and MG132 at different time points. (D) WB analysis of CPT1A in cells with or without TRIM21 silencing in CHX-chase experiment in KGN cells. (E and F) In KGN cells, coimmunoprecipitation (Co-IP) and WB analysis of CPT1A exogenous ubiquitination with TRIM21 knockdown or overexpression in the presence of MG132 (10 μM, 4 h). (G and H) In KGN cells, Co-IP and WB analysis of CPT1A endogenous ubiquitination with TRIM21 knockdown or overexpression in the presence of MG132 (10 μM, 4 h). (I and J) In KGN cells, Co-IP and WB analysis of exogenous ubiquitination of CPT1A treated with Flag-CPT1A and HA-UB (wild type [WT], K48-only, and K63-only) in the presence of MG132 (10 μM, 4 h). (K and L) Analysis of ubiquitination modification sites of CPT1A by immunoprecipitation-mass spectrometry (IP-MS). (M and N) In KGN cells, Co-IP and WB of exogenous ubiquitination of CPT1A treated with Flag-CPT1A mutant plasmids in the presence of MG132 (10 μM, 4 h). Data are expressed as means ± SD. IB, immunoblot.

    Journal: Research

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A

    doi: 10.34133/research.1223

    Figure Lengend Snippet: Tripartite motif-containing protein 21 (TRIM21) facilitates ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) at lysine 161. (A) Reverse transcription polymerase chain reaction (RT-PCR) analysis of CPT1A with or without TRIM21 knockdown of KGN and COV434 cells ( n = 5). (B) Western blot (WB) analysis of CPT1A with TRIM21 overexpression in the presence of MG132 in KGN cells. (C) WB analysis of CPT1A in KGN cells treated with cycloheximide (CHX) and MG132 at different time points. (D) WB analysis of CPT1A in cells with or without TRIM21 silencing in CHX-chase experiment in KGN cells. (E and F) In KGN cells, coimmunoprecipitation (Co-IP) and WB analysis of CPT1A exogenous ubiquitination with TRIM21 knockdown or overexpression in the presence of MG132 (10 μM, 4 h). (G and H) In KGN cells, Co-IP and WB analysis of CPT1A endogenous ubiquitination with TRIM21 knockdown or overexpression in the presence of MG132 (10 μM, 4 h). (I and J) In KGN cells, Co-IP and WB analysis of exogenous ubiquitination of CPT1A treated with Flag-CPT1A and HA-UB (wild type [WT], K48-only, and K63-only) in the presence of MG132 (10 μM, 4 h). (K and L) Analysis of ubiquitination modification sites of CPT1A by immunoprecipitation-mass spectrometry (IP-MS). (M and N) In KGN cells, Co-IP and WB of exogenous ubiquitination of CPT1A treated with Flag-CPT1A mutant plasmids in the presence of MG132 (10 μM, 4 h). Data are expressed as means ± SD. IB, immunoblot.

    Article Snippet: Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300).

    Techniques: Ubiquitin Proteomics, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Knockdown, Western Blot, Over Expression, Co-Immunoprecipitation Assay, Modification, Immunoprecipitation, Mass Spectrometry, Protein-Protein interactions, Mutagenesis

    UBE2M promotes tripartite motif-containing protein 21 (TRIM21) neddylation and its interaction with carnitine palmitoyltransferase 1A (CPT1A). (A) UBE2M was identified as a protein with high confidence interacting with TRIM21 by immunoprecipitation-mass spectrometry (IP-MS) and functional analysis. (B) Molecular docking of UBE2M and TRIM21. (C and D) Coimmunoprecipitation (Co-IP) and Western blot (WB) analysis of exogenous UBE2M and TRIM21 in KGN cells overexpressing Flag-UBE2M and MYC-TRIM21. (E) Immunofluorescence staining of UBE2M and TRIM21 by confocal microscopy in KGN cells (scale bar, 20 μm). (F) WB analysis of TRIM21 and neural precursor cell-expressed developmentally down-regulated 8 (NEDD8) with UBE2M knockdown in KGN cells. (G) WB analysis of KGN cell lysates immunoprecipitated with immunoglobulin G (IgG) and anti-NEDD8 antibodies. (H) Immunofluorescence staining of TRIM21 and NEDD8 by confocal microscopy in KGN cells (scale bar, 20 μm). (I) WB analysis of TRIM21 in KGN cells overexpressing UBE2M with or without NEDD8 knockdown. (J) Co-IP and WB analysis of TRIM21 neddylation with or without UBE2M knockdown in KGN cells. (K) WB analysis of CPT1A in KGN cells treated with different concentrations of FLAG-UBE2M. (L) WB analysis of CPT1A treated with UBE2M silencing, with or without TRIM21 knockdown in KGN cells. (M) Co-IP and WB analysis of KGN cell lysates immunoprecipitated with anti-MYC antibody in the presence of UBE2M knockdown. (N) In KGN cells, Co-IP and WB analysis of TRIM21 neddylation, CPT1A and ATP5A1 with UBE2M silencing, with or without NEDD8 knockdown. (O) In KGN cells, WB analysis of K48 ubiquitination of CPT1A in cells with UBE2M overexpression, with or without TRIM21 knockdown in the presence of MG132 (10 μM, 4 h) treatment. (P) In KGN cells, Co-IP and WB analysis of exogenous K48 ubiquitination of CPT1A in KGN cells with UBE2M overexpression, with or without NEDD8 knockdown in the presence of MG132 (10 μM, 4 h). IB, immunoblot.

    Journal: Research

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A

    doi: 10.34133/research.1223

    Figure Lengend Snippet: UBE2M promotes tripartite motif-containing protein 21 (TRIM21) neddylation and its interaction with carnitine palmitoyltransferase 1A (CPT1A). (A) UBE2M was identified as a protein with high confidence interacting with TRIM21 by immunoprecipitation-mass spectrometry (IP-MS) and functional analysis. (B) Molecular docking of UBE2M and TRIM21. (C and D) Coimmunoprecipitation (Co-IP) and Western blot (WB) analysis of exogenous UBE2M and TRIM21 in KGN cells overexpressing Flag-UBE2M and MYC-TRIM21. (E) Immunofluorescence staining of UBE2M and TRIM21 by confocal microscopy in KGN cells (scale bar, 20 μm). (F) WB analysis of TRIM21 and neural precursor cell-expressed developmentally down-regulated 8 (NEDD8) with UBE2M knockdown in KGN cells. (G) WB analysis of KGN cell lysates immunoprecipitated with immunoglobulin G (IgG) and anti-NEDD8 antibodies. (H) Immunofluorescence staining of TRIM21 and NEDD8 by confocal microscopy in KGN cells (scale bar, 20 μm). (I) WB analysis of TRIM21 in KGN cells overexpressing UBE2M with or without NEDD8 knockdown. (J) Co-IP and WB analysis of TRIM21 neddylation with or without UBE2M knockdown in KGN cells. (K) WB analysis of CPT1A in KGN cells treated with different concentrations of FLAG-UBE2M. (L) WB analysis of CPT1A treated with UBE2M silencing, with or without TRIM21 knockdown in KGN cells. (M) Co-IP and WB analysis of KGN cell lysates immunoprecipitated with anti-MYC antibody in the presence of UBE2M knockdown. (N) In KGN cells, Co-IP and WB analysis of TRIM21 neddylation, CPT1A and ATP5A1 with UBE2M silencing, with or without NEDD8 knockdown. (O) In KGN cells, WB analysis of K48 ubiquitination of CPT1A in cells with UBE2M overexpression, with or without TRIM21 knockdown in the presence of MG132 (10 μM, 4 h) treatment. (P) In KGN cells, Co-IP and WB analysis of exogenous K48 ubiquitination of CPT1A in KGN cells with UBE2M overexpression, with or without NEDD8 knockdown in the presence of MG132 (10 μM, 4 h). IB, immunoblot.

    Article Snippet: Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300).

    Techniques: Immunoprecipitation, Mass Spectrometry, Protein-Protein interactions, Functional Assay, Co-Immunoprecipitation Assay, Western Blot, Immunofluorescence, Staining, Confocal Microscopy, Knockdown, Ubiquitin Proteomics, Over Expression

    MLN4924 reverses the ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) by tripartite motif-containing protein 21 (TRIM21) and ameliorates the phenotype of polycystic ovary syndrome (PCOS) mice. (A) Western blot (WB) analysis of neural precursor cell-expressed developmentally down-regulated 8 (NEDD8) and CPT1A treated with MLN4924, with or without TRIM21 knockdown in KGN cell. (B and C) Coimmunoprecipitation (Co-IP) and WB analysis of TRIM21 neddylation in KGN cells treated with or without MLN4924. (D) Co-IP and WB analysis of exogenous K48 ubiquitination of CPT1A in KGN cells overexpressing UBE2M, with or without NEDD8 knockdown in the presence of MG132 (10 μM, 4 h). (E and F) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR) in KGN cells, including basal respiration, maximum respiration, ATP generation, and coupling efficiency ( n = 6). (G and H) Evaluation of fatty acid oxidation (FAO)-dependent mitochondrial function by OCR in KGN cells, including basal respiration and maximum respiration ( n = 6). (I) Activity of mitochondrial complex V in KGN cells ( n = 6). (J and K) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (L) Anogenital distance in adult female mice ( n = 15). (M) Insulin tolerance test (ITT) test in adult female mice after 4 h of fasting ( n = 5). (N) Number of pups per birth ( n = 10). (O and P) WB and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 and CPT1A in ovarian granulosa cells (GCs). (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± standard error of the mean (SEM), and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (M) was determined by 2-way ANOVA and multiple comparison test. ns, not significant; ** P < 0.01; *** P < 0.001; **** P < 0.0001. IB, immunoblot.

    Journal: Research

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A

    doi: 10.34133/research.1223

    Figure Lengend Snippet: MLN4924 reverses the ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) by tripartite motif-containing protein 21 (TRIM21) and ameliorates the phenotype of polycystic ovary syndrome (PCOS) mice. (A) Western blot (WB) analysis of neural precursor cell-expressed developmentally down-regulated 8 (NEDD8) and CPT1A treated with MLN4924, with or without TRIM21 knockdown in KGN cell. (B and C) Coimmunoprecipitation (Co-IP) and WB analysis of TRIM21 neddylation in KGN cells treated with or without MLN4924. (D) Co-IP and WB analysis of exogenous K48 ubiquitination of CPT1A in KGN cells overexpressing UBE2M, with or without NEDD8 knockdown in the presence of MG132 (10 μM, 4 h). (E and F) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR) in KGN cells, including basal respiration, maximum respiration, ATP generation, and coupling efficiency ( n = 6). (G and H) Evaluation of fatty acid oxidation (FAO)-dependent mitochondrial function by OCR in KGN cells, including basal respiration and maximum respiration ( n = 6). (I) Activity of mitochondrial complex V in KGN cells ( n = 6). (J and K) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (L) Anogenital distance in adult female mice ( n = 15). (M) Insulin tolerance test (ITT) test in adult female mice after 4 h of fasting ( n = 5). (N) Number of pups per birth ( n = 10). (O and P) WB and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 and CPT1A in ovarian granulosa cells (GCs). (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± standard error of the mean (SEM), and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (M) was determined by 2-way ANOVA and multiple comparison test. ns, not significant; ** P < 0.01; *** P < 0.001; **** P < 0.0001. IB, immunoblot.

    Article Snippet: Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300).

    Techniques: Ubiquitin Proteomics, Western Blot, Knockdown, Co-Immunoprecipitation Assay, Phospho-proteomics, Activity Assay, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Immunohistochemical staining, Staining, Comparison

    MLN4924 improves the quality of oocytes of polycystic ovary syndrome (PCOS) mice. (A) Hematoxylin and eosin (H&E) staining of ovaries and the number of follicles in ovary including primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (B) Number of oocytes after superovulation ( n = 5 mice; scale bars, 100 μm). (C) Representative images and percentage of first polar body extrusion in mouse oocytes, fertilization rate, and blastocyst maturation rate ( n = 5 mice; scale bars, 100 μm). (D) Transmission electron microscopy (TEM) analysis of mitochondrial morphology of mouse ovarian granulosa cells. Green arrows indicate normal mitochondria, red arrows indicate abnormal mitochondria, and # indicates lipid droplets ( n = 5 mice; scale bar, 500 nm). (E) Representative images of spindle morphology and chromosome alignment in oocytes at the metaphase II stage by confocal microscopy ( n = 5 mice; scale bar, 10 μm). The percentage of aberrant spindles and misaligned chromosomes were quantified in oocytes at metaphase II from control ( n = 23), PCOS ( n = 19), and MLN4924 ( n = 21) mice. (F) Representative images for JC-1 staining of mouse oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected (G) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) staining of mouse oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. (H) Representative images for lipid content in oocytes ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities. Three fields of view of each mouse were selected. (I) Reverse transcription polymerase chain reaction (RT-PCR) analysis of mRNA levels of follicle development-related genes in mouse cumulus–oocyte complexes (COCs) ( n = 5). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. (J) Schematic diagram of the pathway by which tripartite motif-containing protein 21 (TRIM21) regulates ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) leading to abnormal fatty acid oxidation in ovarian granulosa cells. ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Journal: Research

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A

    doi: 10.34133/research.1223

    Figure Lengend Snippet: MLN4924 improves the quality of oocytes of polycystic ovary syndrome (PCOS) mice. (A) Hematoxylin and eosin (H&E) staining of ovaries and the number of follicles in ovary including primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (B) Number of oocytes after superovulation ( n = 5 mice; scale bars, 100 μm). (C) Representative images and percentage of first polar body extrusion in mouse oocytes, fertilization rate, and blastocyst maturation rate ( n = 5 mice; scale bars, 100 μm). (D) Transmission electron microscopy (TEM) analysis of mitochondrial morphology of mouse ovarian granulosa cells. Green arrows indicate normal mitochondria, red arrows indicate abnormal mitochondria, and # indicates lipid droplets ( n = 5 mice; scale bar, 500 nm). (E) Representative images of spindle morphology and chromosome alignment in oocytes at the metaphase II stage by confocal microscopy ( n = 5 mice; scale bar, 10 μm). The percentage of aberrant spindles and misaligned chromosomes were quantified in oocytes at metaphase II from control ( n = 23), PCOS ( n = 19), and MLN4924 ( n = 21) mice. (F) Representative images for JC-1 staining of mouse oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected (G) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) staining of mouse oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. (H) Representative images for lipid content in oocytes ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities. Three fields of view of each mouse were selected. (I) Reverse transcription polymerase chain reaction (RT-PCR) analysis of mRNA levels of follicle development-related genes in mouse cumulus–oocyte complexes (COCs) ( n = 5). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. (J) Schematic diagram of the pathway by which tripartite motif-containing protein 21 (TRIM21) regulates ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) leading to abnormal fatty acid oxidation in ovarian granulosa cells. ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Article Snippet: Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300).

    Techniques: Staining, Transmission Assay, Electron Microscopy, Confocal Microscopy, Control, Fluorescence, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Ubiquitin Proteomics

    IFI35 ubiquitinates HNF4a in TRIM21-dependent manner. A Cell lysates were immunoprecipitated using an anti-TRIM21 antibody. B Detection of HBV DNAs by Southern blot from HepG2 and HepG2-TRIM21-KO cells. Expression levels of HNF4α, IFI35 and TRIM21 in HepG2-TRIM21-KO cells compared to parental HepG2 cells (Control) were assessed by Western blot. HBV DNA levels of HepG2 and HepG2-TRIM21-KO cells were quantified in graph (bottom). C Quantification of HNF4α protein levels in HepG2 and HepG2-TRIM21 knockout (KO) cells transfected with increasing amounts of myc-IFI35. HNF4α levels were determined by immunoblotting and quantified relative to the vector control. Data represent mean ± SD from three independent experiments. D Secreted HBeAg and HBsAg levels were measured by ELISA in HepG2 and HepG2-TRIM21-KO cells transfected with increasing amounts of myc-IFI35. Data represent mean ± SD from three independent experiments. E HepG2 or HepG2-TRIM21 knockout cells were transfected with HBV 1.2mer together with increasing amounts of IFI35. Total RNA was analyzed by Northern blotting to detect HBV transcription. F Effect of TRIM21 on IFI35-mediated HNF4α degradation. HepG2 and HepG2-TRIM21-KO cells were transfected with either empty vector or myc-IFI35. After 48 h, cycloheximide (50ug/ml) were treated for the indicated times, and cells were harvested. Expression levels of HNF4α and IFI35 were evaluated through Western blotting. Quantification of HNF4α levels between HepG2 and HepG2-TRIM21-KO cells (bottom). G HepG2 cells and TRIM21 knockout cells were co-transfected with HA-tagged ubiquitin (1 μg) and either vector or IFI35 (2 μg). At 48 h post-transfection, HNF4α was immunoprecipitated and immunoblotted with anti-ubiquitin antibody to assess polyubiquitination. Total levels of HNF4α, IFI35, TRIM21, and HA-tagged ubiquitin in input lysates were also analyzed by immunoblotting. H Schematic diagram of HBV enhancer luciferase reporter constructs. Constructs containing enhancer I (EnhI), enhancer II (EnhII), or both regions were cloned upstream of the luciferase reporter gene. Mutant constructs lacking HNF4α binding sites were generated in EnhI (ΔHNF4α) or EnhII (ΔHNF4α1 and ΔHNF4α1,2) as indicated. I Basal luciferase activity of HBV enhancer reporter constructs. HepG2 cells were transfected with the indicated luciferase reporter plasmids, and luciferase activity was measured. J Comparison of the effect of IFI35 on EnhI-driven transcription with or without the HNF4α binding site. HepG2 cells were co-transfected with the indicated EnhI luciferase reporters and increasing amounts of myc-IFI35. Luciferase activity was measured 48 h post-transfection. Data represent mean ± SD from three independent experiments. K Comparison of the effect of IFI35 on EnhII-driven transcription with or without HNF4α binding sites. HepG2 cells were co-transfected with EnhII luciferase reporters containing wild-type or mutated HNF4α binding sites together with increasing amounts of myc-IFI35. Luciferase activity was measured 48 h post-transfection. Data represent mean ± SD from three independent experiments. The above experiment was independently conducted three times. Data are shown as mean ± SD. The statistical significance of the differences was assessed by the Student t test: *, P < 0.05; **, P < 0.01, ***, P < 0.001

    Journal: Journal of Biomedical Science

    Article Title: IFI35 suppresses the transcription of hepatitis B virus cccDNA minichromosome via promoting HNF4α proteasomal degradation

    doi: 10.1186/s12929-026-01239-w

    Figure Lengend Snippet: IFI35 ubiquitinates HNF4a in TRIM21-dependent manner. A Cell lysates were immunoprecipitated using an anti-TRIM21 antibody. B Detection of HBV DNAs by Southern blot from HepG2 and HepG2-TRIM21-KO cells. Expression levels of HNF4α, IFI35 and TRIM21 in HepG2-TRIM21-KO cells compared to parental HepG2 cells (Control) were assessed by Western blot. HBV DNA levels of HepG2 and HepG2-TRIM21-KO cells were quantified in graph (bottom). C Quantification of HNF4α protein levels in HepG2 and HepG2-TRIM21 knockout (KO) cells transfected with increasing amounts of myc-IFI35. HNF4α levels were determined by immunoblotting and quantified relative to the vector control. Data represent mean ± SD from three independent experiments. D Secreted HBeAg and HBsAg levels were measured by ELISA in HepG2 and HepG2-TRIM21-KO cells transfected with increasing amounts of myc-IFI35. Data represent mean ± SD from three independent experiments. E HepG2 or HepG2-TRIM21 knockout cells were transfected with HBV 1.2mer together with increasing amounts of IFI35. Total RNA was analyzed by Northern blotting to detect HBV transcription. F Effect of TRIM21 on IFI35-mediated HNF4α degradation. HepG2 and HepG2-TRIM21-KO cells were transfected with either empty vector or myc-IFI35. After 48 h, cycloheximide (50ug/ml) were treated for the indicated times, and cells were harvested. Expression levels of HNF4α and IFI35 were evaluated through Western blotting. Quantification of HNF4α levels between HepG2 and HepG2-TRIM21-KO cells (bottom). G HepG2 cells and TRIM21 knockout cells were co-transfected with HA-tagged ubiquitin (1 μg) and either vector or IFI35 (2 μg). At 48 h post-transfection, HNF4α was immunoprecipitated and immunoblotted with anti-ubiquitin antibody to assess polyubiquitination. Total levels of HNF4α, IFI35, TRIM21, and HA-tagged ubiquitin in input lysates were also analyzed by immunoblotting. H Schematic diagram of HBV enhancer luciferase reporter constructs. Constructs containing enhancer I (EnhI), enhancer II (EnhII), or both regions were cloned upstream of the luciferase reporter gene. Mutant constructs lacking HNF4α binding sites were generated in EnhI (ΔHNF4α) or EnhII (ΔHNF4α1 and ΔHNF4α1,2) as indicated. I Basal luciferase activity of HBV enhancer reporter constructs. HepG2 cells were transfected with the indicated luciferase reporter plasmids, and luciferase activity was measured. J Comparison of the effect of IFI35 on EnhI-driven transcription with or without the HNF4α binding site. HepG2 cells were co-transfected with the indicated EnhI luciferase reporters and increasing amounts of myc-IFI35. Luciferase activity was measured 48 h post-transfection. Data represent mean ± SD from three independent experiments. K Comparison of the effect of IFI35 on EnhII-driven transcription with or without HNF4α binding sites. HepG2 cells were co-transfected with EnhII luciferase reporters containing wild-type or mutated HNF4α binding sites together with increasing amounts of myc-IFI35. Luciferase activity was measured 48 h post-transfection. Data represent mean ± SD from three independent experiments. The above experiment was independently conducted three times. Data are shown as mean ± SD. The statistical significance of the differences was assessed by the Student t test: *, P < 0.05; **, P < 0.01, ***, P < 0.001

    Article Snippet: The following antibodies were used: IFI35 (sc-100769, Santa Cruz), HNF4α (H-171, Santa Cruz), HNF1α (Η-140, Santa Cruz), HNF3β (RY-7, Santa Cruz), core protein (B0586, Dako, Carpinteria, CA), TRIM21 (sc-25351, Santa Cruz), β-actin (A5441, Sigma) and GFP (sc-9996, Santa Cruz).

    Techniques: Immunoprecipitation, Southern Blot, Expressing, Control, Western Blot, Knock-Out, Transfection, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Northern Blot, Ubiquitin Proteomics, Luciferase, Construct, Clone Assay, Mutagenesis, Binding Assay, Generated, Activity Assay, Comparison

    Domain mapping of IFI35 as mediators of TRIM21–HNF4α complex formation. A Schematic representation of IFI35 constructs used in this study. GFP-tagged mutants lacking NID1 (ΔNID1) or NID2 (ΔNID2), as well as the leucine zipper construct (Zip), were generated. B HepG2 cells were co-transfected with HBV 1.2mer and the indicated IFI35 constructs. At 72 h post-transfection, HBV replication intermediates were analyzed by Southern blotting. Quantification of HBV replication levels based on Southern blot analysis. C Secreted HBeAg and HBsAg levels in the culture supernatants were measured by ELISA. E Co-immunoprecipitation analysis of IFI35 mutants with HNF4α. HepG2 cells were transfected with GFP-tagged IFI35 constructs and cell lysates were immunoprecipitated using anti-HNF4α antibody followed by immunoblotting with anti-GFP antibody. F Interaction of IFI35 mutants with TRIM21. Cells were transfected with Myc-TRIM21 together with the indicated IFI35 constructs. Cell lysates were subjected to immunoprecipitation using anti-TRIM21 antibody followed by immunoblotting with anti-GFP antibody. Data represent mean ± SD (n = 3). Statistical significance was determined relative to the vector control

    Journal: Journal of Biomedical Science

    Article Title: IFI35 suppresses the transcription of hepatitis B virus cccDNA minichromosome via promoting HNF4α proteasomal degradation

    doi: 10.1186/s12929-026-01239-w

    Figure Lengend Snippet: Domain mapping of IFI35 as mediators of TRIM21–HNF4α complex formation. A Schematic representation of IFI35 constructs used in this study. GFP-tagged mutants lacking NID1 (ΔNID1) or NID2 (ΔNID2), as well as the leucine zipper construct (Zip), were generated. B HepG2 cells were co-transfected with HBV 1.2mer and the indicated IFI35 constructs. At 72 h post-transfection, HBV replication intermediates were analyzed by Southern blotting. Quantification of HBV replication levels based on Southern blot analysis. C Secreted HBeAg and HBsAg levels in the culture supernatants were measured by ELISA. E Co-immunoprecipitation analysis of IFI35 mutants with HNF4α. HepG2 cells were transfected with GFP-tagged IFI35 constructs and cell lysates were immunoprecipitated using anti-HNF4α antibody followed by immunoblotting with anti-GFP antibody. F Interaction of IFI35 mutants with TRIM21. Cells were transfected with Myc-TRIM21 together with the indicated IFI35 constructs. Cell lysates were subjected to immunoprecipitation using anti-TRIM21 antibody followed by immunoblotting with anti-GFP antibody. Data represent mean ± SD (n = 3). Statistical significance was determined relative to the vector control

    Article Snippet: The following antibodies were used: IFI35 (sc-100769, Santa Cruz), HNF4α (H-171, Santa Cruz), HNF1α (Η-140, Santa Cruz), HNF3β (RY-7, Santa Cruz), core protein (B0586, Dako, Carpinteria, CA), TRIM21 (sc-25351, Santa Cruz), β-actin (A5441, Sigma) and GFP (sc-9996, Santa Cruz).

    Techniques: Construct, Generated, Transfection, Southern Blot, Enzyme-linked Immunosorbent Assay, Immunoprecipitation, Western Blot, Plasmid Preparation, Control